
Reagent-Free Colorimetric Assay for Galactose Utilizing Agarose Gel Entrapping Nanoceria

Desloratadine, a Novel Antigrowth Reagent for Bladder Most cancers.

Desloratadine, a potent antagonist for human histamine H1 receptor, has been revealed to exhibit antihistaminic exercise and anti inflammatory exercise. Nonetheless, it isn’t but recognized whether or not desloratadine has any impact on the organic behaviors of tumor cells. On this research, we aimed to research the results of desloratadine on cell development and invasion in bladder most cancers EJ and SW780 cells in vitro.

We noticed that desloratadine inhibited cell viability of EJ and SW780 cells in a dose- and time-dependent method. Desloratadine remedy was additionally revealed to suppress colony-formation capacity and induce cell cycle arrest at G1 section in EJ cells. Desloratadine promoted cell apoptosis through modulating the expression of Bcl-2, Bax, cleaved caspase 3, and cleaved caspase 9 in EJ and SW780 cells.

Western blot resulted confirmed that desloratadine additionally impaired the expression of autophagy-related proteins, reminiscent of Beclin 1, P62, and LC3I/II in EJ and SW780 cells; whereas autophagy inhibitor LY294002 reversed the results of desloratadine on these proteins.

Furthermore, desloratadine remarkably attenuated cell migration and invasion. Moreover, we illustrated that desloratadine downregulated the expression of N-cadherin, Vimentin, Snail1, and Snail2, whereas upregulated the expression of E-cadherin in EJ and SW780 cells in vitro.

The extent of interleukin 6 was diminished in desloratadine-treated cells, whereas upregulation of interleukin 6 considerably abolished the anticancer exercise of desloratadine in cell invasion and Bcl-2, Bax, Beclin1, LC3-I/II, N-cadherin, and E-cadherin expression in EJ cells.

Taken collectively, our knowledge recommend a possible anticancer exercise of desloratadine on cell development and invasion for bladder most cancers, which can be mediated by diminishing the epithelial-to-mesenchymal transition and interleukin 6.


Anti-HMGB1 antibody

PAab03924 100 ug
EUR 355

Anti-HMGB1 antibody

STJ24037 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ24039 100 µl
EUR 413
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ29816 100 µl
EUR 457
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 Antibody

STJ501358 100 µg
EUR 476

Anti-HMGB1 (1D5)

YF-MA10425 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B11)

YF-MA10426 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (2F6)

YF-MA10427 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B2)

YF-MA13482 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D10)

YF-MA13483 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D9)

YF-MA13484 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

HMGB1, human

RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

Anti-HMGB1 Antibody (Biotin)

STJ501359 100 µg
EUR 586

Anti-HMGB1 Antibody (FITC)

STJ501360 100 µg
EUR 586

Anti-HMGB1 (1E6-E10)

YF-MA10424 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-Bovine HMGB1 IgG Antibodies

7028 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgG Antibodies

Anti-Bovine HMGB1 IgY Antibodies

7064 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgY Antibodies

Anti-HMGB1 Antibody (monoclonal, 5H3)

M00066-2 100ug/vial
EUR 334

Anti-HMGB1 (KO Validated) Antibody

A2127-100 100 µl
EUR 399

Recombinant Human HMGB1

P0194 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09429
Description: Recombinant Human protein for HMGB1

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

HMGB1 protein

30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody

70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

EUR 452

HMGB1 Antibody

33661-100ul 100ul
EUR 252

HMGB1 Antibody

33661-50ul 50ul
EUR 187

HMGB1 antibody

38424-100ul 100ul
EUR 252

HMGB1 antibody

10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 Antibody

48606-100ul 100ul
EUR 333

HMGB1 Antibody

48606-50ul 50ul
EUR 239

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody

DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Bovine HMGB1

9050 1 mg/ml x 0.1 ml
EUR 309.55
Description: Bovine HMGB1

HMGB1 Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HMGB1 Antibody

AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Protein

  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody

ABF7020 100 ug
EUR 438

HMGB1 Antibody

ABD3077 100 ug
EUR 438

HMGB1 Antibody

ABD7008 100 ug
EUR 438


PVT10093 2 ug
EUR 266

HMGB1 Plasmid

PVT7114 2 ug
EUR 266

Anti-HMGB1 Peptide (2-11) Antibodies

7029 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-HMGB1 Peptide (2-11) Antibodies

Anti-HMGB1 Peptide (166-176) Antibodies

7030 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-HMGB1 Peptide (166-176) Antibodies


ELA-E0399h 96 Tests
EUR 824


EHH0016 96Tests
EUR 521


EF000598 96 Tests
EUR 689

Human HMGB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human HMGB1 Protein

RP00010 5 μg
EUR 136

HMGB1 Recombinant Protein (Human)

RP014974 100 ug Ask for price

HMGB1 Recombinant Protein (Human)

RP014977 100 ug Ask for price

Antibody for Human HMGB1

SPC-1259D 0.1ml
EUR 314
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is unconjugated.

Antibody for Human HMGB1

SPC-1259D-A390 0.1ml
EUR 361
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 390.

Antibody for Human HMGB1

SPC-1259D-A488 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 488.

Antibody for Human HMGB1

SPC-1259D-A565 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 565.

Antibody for Human HMGB1

SPC-1259D-A594 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 594.

Antibody for Human HMGB1

SPC-1259D-A633 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 633.

Antibody for Human HMGB1

SPC-1259D-A655 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 655.

Antibody for Human HMGB1

SPC-1259D-A680 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 680.

Antibody for Human HMGB1

SPC-1259D-A700 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 700.

Antibody for Human HMGB1

SPC-1259D-ALP 0.1ml
EUR 355
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human HMGB1

SPC-1259D-APC 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to APC .

Antibody for Human HMGB1

SPC-1259D-APCCY7 0.1ml
EUR 432
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to APC/Cy7.

Antibody for Human HMGB1

SPC-1259D-BI 0.1ml
EUR 357
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Biotin.

Antibody for Human HMGB1

SPC-1259D-DY350 0.1ml
EUR 436
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 350.

Antibody for Human HMGB1

SPC-1259D-DY405 0.1ml
EUR 412
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 405.

Antibody for Human HMGB1

SPC-1259D-DY488 0.1ml
EUR 393
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 488.

Antibody for Human HMGB1

SPC-1259D-DY594 0.1ml
EUR 397
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 594.

Antibody for Human HMGB1

SPC-1259D-DY633 0.1ml
EUR 387
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 633.

Antibody for Human HMGB1

SPC-1259D-FITC 0.1ml
EUR 353
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to FITC.

Antibody for Human HMGB1

SPC-1259D-HRP 0.1ml
EUR 349
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to HRP.

Antibody for Human HMGB1

SPC-1259D-P594 0.1ml
EUR 367
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to PE/ATTO 594.

Antibody for Human HMGB1

SPC-1259D-PCP 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to PerCP.

Antibody for Human HMGB1

SPC-1259D-RPE 0.1ml
EUR 358
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to RPE .

Antibody for Human HMGB1

SPC-1259D-STR 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Streptavidin.


STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids

Anti-Bovine HMGB1 Antibody, Clone 1-37.10FH

7047 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 Antibody

Anti-HMGB1/Hmg 1 Rabbit Monoclonal Antibody

M00066-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal HMGB1/Hmg 1 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

HMGB1 protein (Mouse)

30R-2278 100 ug
EUR 2012
Description: Purified recombinant Mouse HMGB1 protein

HMGB1 Rabbit pAb

A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb

A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb

A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb

A0718-50ul 50 ul Ask for price

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

HMGB1 antibody (HRP)

60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)

60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)

60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)


DEIA6297V2 96T
EUR 876
Description: CD provides a capture ELISA kit to determine HMGB1 levels in cell culture medium and sera. This kit contains enough reagents to measure 40 samples in duplicate together with standards.

HMGB1 Blocking Peptide

DF3077-BP 1mg
EUR 195

HMGB1 Blocking Peptide

DF7008-BP 1mg
EUR 195

HMGB1 Polyclonal Antibody

A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

HMGB1 (AcK12) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


E21-357 10ug
EUR 343

HMGB1 Conjugated Antibody

C48606 100ul
EUR 397

HMGB1 Blocking Peptide

AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody

C33661 100ul
EUR 397

HMGB1 cloning plasmid

CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 Polyclonal Antibody

A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

pShuttle- CMV- HMGB1

PVT10158 2 ug
EUR 301

pcDNA3.1(+)-HMGB1 Plasmid

PVTB50051-2a 2 ug
EUR 356


PVT18174 2 ug
EUR 231

pET28a-HMGB1 Plasmid

PVTB00031-1a 2 ug
EUR 356

HMGB1 ORF Vector (Human) (pORF)

ORF004992 1.0 ug DNA
EUR 95

HMGB1 ORF Vector (Human) (pORF)

ORF004993 1.0 ug DNA
EUR 95

HMGB1 ELISA Kit (Human) (OKAN06342)

OKAN06342 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06343)

OKAN06343 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL

HMGB1 ELISA Kit (Human) (OKCD04074)

OKCD04074 96 Wells
EUR 753
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

Human CellExp? HMGB1 /HMG1, human recombinant

EUR 229

Human CellExp? HMGB1 /HMG1, human recombinant

EUR 582

Anti-Bovine HMGB1 Antibody, Clone 1-37.10FH, Biotinylated

70471 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 Antibody

Rabbit Anti-HMGB1 monoclonal antibody, clone TB40-14

CABT-L566 100 ul
EUR 777

Human CellExp? HMGB1 /HMG1, Mouse Recombinant

EUR 185

Human CellExp? HMGB1 /HMG1, Mouse Recombinant

EUR 490

Acetyl-HMGB1 (K12) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-HMGB1 (K12). Recognizes Acetyl-HMGB1 (K12) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

HMGB1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HMGB1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HMGB1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HMGB1 (AcK12) Blocking Peptide

  • EUR 300.00
  • EUR 495.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.


EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit

EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit

ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit

ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit

EAH0016 96Tests
EUR 521

Rat HMGB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMGB1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HMGB1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HMGB1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse HMGB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMGB1 recombinant monoclonal antibody

A5052 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HMGB1 for WB, IF,ELISA


ERH0016 96Tests
EUR 521


ESH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit

ERTH0016 96Tests
EUR 521


EMH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit

EMKH0016 96Tests
EUR 521

Porcine HMGB1 ELISA Kit

EPH0016 96Tests
EUR 521

pCMV-HA-HMGB1 Plasmid

PVTB00732-2a 2 ug
EUR 356


PVT12760 2 ug
EUR 703

HMGB1 Recombinant Protein (Rat)

RP204722 100 ug Ask for price

HMGB1 Recombinant Protein (Mouse)

RP141866 100 ug Ask for price


STJ150371 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids


STJ150484 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Mouse serum, plasma and other biological fluids

Reagent-Free Colorimetric Assay for Galactose Utilizing Agarose Gel Entrapping Nanoceria and Galactose Oxidase.

A reagent-free colorimetric technique for galactose quantification utilizing a composite of cerium oxide nanoparticles (nanoceria) and galactose oxidase (Gal Ox) entrapped in an agarose gel was developed. Within the presence of galactose, the Gal Ox entrapped inside the agarose gel catalyzed the oxidation of galactose to generate H2O2, which induced a shade change from white to intense yellow.

This response occurred with none chromogenic substrate. This shade transition is presumed to be as a result of H2O2-mediated alteration of the oxidation state of cerium ions current on the floor of the nanoceria.

The depth of shade change was quantified by buying a picture with a traditional smartphone, changing the picture to cyan-magenta-yellow-black (CMYK) mode, and subsequently analyzing the picture utilizing the ImageJ software program.

Utilizing this technique, galactose focus was particularly decided with wonderful sensitivity of as little as 0.05 mM. The analytical utility of the assay was efficiently verified by appropriately figuring out various ranges of galactose in human serum, which is sufficient to diagnose galactosemia, a genetic dysfunction characterised by the malfunctioning of enzymes liable for galactose metabolism.

The assay using a hydrogel composite with entrapped nanoceria and Gal Ox, is an easy, cost-effective, and speedy colorimetric assay for galactose quantification, with out utilizing any chromogenic reagent. This cost-effective technique has nice potential for the analysis of galactosemia and is very promising compared to the laborious instrumentation-based strategies at the moment in use.

Uneven copper-catalyzed conjugate additions of organometallic reagents within the syntheses of pure compounds and prescribed drugs. 

Entry to enantiopure complicated molecular constructions is essential for the event of latest medicine in addition to brokers utilized in crop-protection. On this regard, quite a few uneven strategies have been established. Copper-catalyzed 1,4-additions of organometallic reagents are strong C-C bond formation methods relevant in a variety of circumstances.

This evaluation analyses the syntheses of pure merchandise and pharmaceutical brokers, which depend on the appliance of uneven Cu-catalyzed conjugate additions of assorted organometallic reagents. A variety of accessible organometallics, e.g. dialkylzinc, trialkylaluminum, Grignard, and organozirconium, can now be utilized in conjugate additions to deal with numerous artificial challenges current in focused pure compounds. Moreover, environment friendly catalysts permit excessive ranges of stereofidelity over a various array of beginning Michael acceptors.

Anti-CD97 antibody

STJ16100121 100 µg
EUR 406

Anti-CD97 antibody

STJ23018 100 µl
EUR 277
Description: This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19.

Anti-CD97 (5D5)

YF-MA12353 100 ug
EUR 363
Description: Mouse monoclonal to CD97

Anti-CD97 (3B11)

YF-MA12354 100 ug
EUR 363
Description: Mouse monoclonal to CD97

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-Hu CD97 Purified

11-267-C025 0.025 mg
EUR 104

Anti-Hu CD97 Purified

11-267-C100 0.1 mg
EUR 167

Anti-Hu CD97 FITC

1F-267-T025 25 tests
EUR 122

Anti-Hu CD97 FITC

1F-267-T100 100 tests
EUR 204

Anti-CD97 Monoclonal Antibody

M02982 100ug
EUR 397
Description: Rabbit Monoclonal CD97 Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Cd97 (mouse) antibody

STJ72921 100 µg
EUR 359

Human CD97 antigen(CD97) ELISA kit

CSB-EL004972HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD97 antigen (CD97) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CD97 antigen(CD97) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CD97 antigen(CD97) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human CD97 antigen, CD97 ELISA KIT

ELI-34081h 96 Tests
EUR 824

Mouse Anti Human Cd97 Monoclonal Antibody

CABT-46901MH 0.2 mg
EUR 767

Mouse Anti Human Cd97 Monoclonal Antibody,APC

CABT-46897MH 100 TEST
EUR 767

Mouse Anti Human Cd97 Monoclonal Antibody,RPE

CABT-46903MH 100 TEST
EUR 710

Bovine CD97 antigen, CD97 ELISA KIT

ELI-10709b 96 Tests
EUR 928

Mouse CD97 antigen, Cd97 ELISA KIT

ELI-50287m 96 Tests
EUR 865

CD97 antibody

70R-16291 50 ul
EUR 435
Description: Rabbit polyclonal CD97 antibody

CD97 Antibody

37886-100ul 100ul
EUR 252

CD97 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD97. Recognizes CD97 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CD97 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CD97. Recognizes CD97 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CD97 Antibody

DF2307 200ul
EUR 304
Description: CD97 antibody detects endogenous levels of total CD97.

CD97 Antibody

DF8153 200ul
EUR 304
Description: CD97 Antibody detects endogenous levels of total CD97.

CD97 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD97. Recognizes CD97 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

CD97 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CD97. Recognizes CD97 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CD97 Antibody

  • EUR 467.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 1-2 weeks.

CD97 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD97 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD97 Antibody

ABD13037 100 ug
EUR 438

CD97 Antibody

ABD2307 100 ug
EUR 438

CD97 Antibody

ABD8153 100 ug
EUR 438

CD97 Antibody

ABD8253 100 ug
EUR 438

Recombinant Human Haptoglobin/Zonulin (C-6His)

CD97-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of PBS, 1mM DTT, pH7.4.

Recombinant Human Haptoglobin/Zonulin (C-6His)

CD97-1mg 1mg
EUR 2486
Description: Lyophilized from a 0.2 μm filtered solution of PBS, 1mM DTT, pH7.4.

Recombinant Human Haptoglobin/Zonulin (C-6His)

CD97-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, 1mM DTT, pH7.4.

Recombinant Human Haptoglobin/Zonulin (C-6His)

CD97-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of PBS, 1mM DTT, pH7.4.

Human CD97 ELISA kit

E01C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD97 ELISA kit

E01C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD97 ELISA kit

E01C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CD97 ELISA Kit

EHC0586 96Tests
EUR 521


EF008532 96 Tests
EUR 689

Human CD97 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD97 (Human) ELISA Kit

E4806-100 96assays
EUR 784

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

CD97 alpha antibody

70R-31186 100 ug
EUR 327
Description: Rabbit polyclonal CD97 alpha antibody

CD97 Blocking Peptide

DF2307-BP 1mg
EUR 195

CD97 Blocking Peptide

DF8153-BP 1mg
EUR 195

CD97 Conjugated Antibody

C37886 100ul
EUR 397

CD97 Rabbit pAb

A3780-100ul 100 ul
EUR 308

CD97 Rabbit pAb

A3780-200ul 200 ul
EUR 459

CD97 Rabbit pAb

A3780-20ul 20 ul
EUR 183

CD97 Rabbit pAb

A3780-50ul 50 ul
EUR 223

ELISA kit for Human CD97

EK5650 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CD97 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD97 PicoKine ELISA Kit

EK1402 96 wells
EUR 425
Description: For quantitative detection of human CD97 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

CD97 ORF Vector (Human) (pORF)

ORF017068 1.0 ug DNA
EUR 405

CD97 beta antibody (Ser531)

70R-31188 100 ug
EUR 327
Description: Rabbit polyclonal CD97 beta antibody (Ser531)

Cleaved-CD97 (L530) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-CD97 (L530). Recognizes Cleaved-CD97 (L530) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Cleaved-CD97 (S531) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-CD97 (S531). Recognizes Cleaved-CD97 (S531) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Goat CD97 ELISA kit

E06C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD97 ELISA kit

E06C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD97 ELISA kit

E06C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD97 ELISA kit

E03C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD97 ELISA kit

E03C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CD97 ELISA kit

E03C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD97 ELISA kit

E04C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD97 ELISA kit

E04C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CD97 ELISA kit

E04C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD97 ELISA kit

E02C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD97 ELISA kit

E02C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CD97 ELISA kit

E02C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD97 ELISA kit

E09C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD97 ELISA kit

E09C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CD97 ELISA kit

E09C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CD97 ELISA Kit

EGTC0586 96Tests
EUR 521

Dog CD97 ELISA kit

E08C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD97 ELISA kit

E08C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CD97 ELISA kit

E08C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD97 ELISA kit

E07C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD97 ELISA kit

E07C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CD97 ELISA kit

E07C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine CD97 ELISA Kit

EBC0586 96Tests
EUR 521

Canine CD97 ELISA Kit

ECC0586 96Tests
EUR 521

Anserini CD97 ELISA Kit

EAC0586 96Tests
EUR 521

Mouse CD97 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD97 Monoclonal Antibody [RMC972A]

A68446 100 µl
EUR 628.55
Description: fast delivery possible

Mouse CD97 ELISA Kit

EMC0586 96Tests
EUR 521

Rat CD97 ELISA Kit

ERC0586 96Tests
EUR 521

Rabbit CD97 ELISA Kit

ERTC0586 96Tests
EUR 521

Porcine CD97 ELISA Kit

EPC0586 96Tests
EUR 521

pDsRed-CD97-RFP Plasmid

PVTB00662-2a 2 ug
EUR 356

Human CD97 Antigen (ADGRE5) ELISA Kit

abx351434-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

CD97 sgRNA CRISPR Lentivector set (Human)

K0404901 3 x 1.0 ug
EUR 339

CD97 sgRNA CRISPR Lentivector (Human) (Target 1)

K0404902 1.0 ug DNA
EUR 154

CD97 sgRNA CRISPR Lentivector (Human) (Target 2)

K0404903 1.0 ug DNA
EUR 154

CD97 sgRNA CRISPR Lentivector (Human) (Target 3)

K0404904 1.0 ug DNA
EUR 154

CD97 Protein Vector (Human) (pPB-C-His)

PV068269 500 ng
EUR 811

CD97 Protein Vector (Human) (pPB-N-His)

PV068270 500 ng
EUR 811

CD97 Protein Vector (Human) (pPM-C-HA)

PV068271 500 ng
EUR 811

CD97 Protein Vector (Human) (pPM-C-His)

PV068272 500 ng
EUR 811

Guinea pig CD97 ELISA kit

E05C0579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD97 ELISA kit

E05C0579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CD97 ELISA kit

E05C0579-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig CD97 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CD97 alpha (Cleaved-Leu530) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

CD97 beta (Cleaved-Ser531) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Guinea Pig CD97 ELISA Kit

EGC0586 96Tests
EUR 521

Polyclonal CD97 Antibody (C-term)

AMM05725G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD97 (C-term). This antibody is tested and proven to work in the following applications:

Cleaved-CD97? (L530) Polyclonal Antibody

ES8096-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cleaved-CD97? (L530) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-CD97? (L530) Polyclonal Antibody

ES8096-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cleaved-CD97? (L530) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-CD97? (S531) Polyclonal Antibody

ES8097-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cleaved-CD97? (S531) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-CD97? (S531) Polyclonal Antibody

ES8097-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cleaved-CD97? (S531) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cd97 ORF Vector (Rat) (pORF)

ORF064689 1.0 ug DNA
EUR 506

Cd97 ORF Vector (Mouse) (pORF)

ORF040918 1.0 ug DNA
EUR 506

Cd97 ORF Vector (Mouse) (pORF)

ORF040919 1.0 ug DNA
EUR 506

Cd97 ORF Vector (Mouse) (pORF)

ORF040920 1.0 ug DNA
EUR 506

Cd97 ORF Vector (Mouse) (pORF)

ORF040921 1.0 ug DNA
EUR 506

Cluster Of Differentiation 97 (CD97) Monoclonal Antibody (Human)

  • EUR 221.00
  • EUR 2114.00
  • EUR 535.00
  • EUR 274.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Pro58~Met260
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Cluster Of Differentiation 97 (CD97)

Polyclonal ADGRE5 / CD97 Antibody (N-Terminus)

APG03128G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADGRE5 / CD97 (N-Terminus). This antibody is tested and proven to work in the following applications:

Cluster of Differentiation 97 (CD97) Antibody

abx027594-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cluster of Differentiation 97 (CD97) Antibody

abx027594-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cluster Of Differentiation 97 (CD97) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 97 (CD97) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cluster of Differentiation 97 (CD97) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 97 (CD97) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cluster of Differentiation 97 (CD97) Antibody

abx139344-01mg 0.1 mg
EUR 370
  • Shipped within 5-12 working days.

Rat CD97 Antigen (ADGRE5) ELISA Kit

abx256788-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Pig CD97 Antigen (ADGRE5) ELISA Kit

abx360526-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit CD97 Antigen (ADGRE5) ELISA Kit

abx362179-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cluster Of Differentiation 97 (CD97) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse CD97 Antigen (ADGRE5) ELISA Kit

abx352593-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Chicken CD97 Antigen (ADGRE5) ELISA Kit

abx357042-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey CD97 Antigen (ADGRE5) ELISA Kit

abx358941-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Cluster Of Differentiation 97 (CD97) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster Of Differentiation 97 (CD97) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster of Differentiation 97 (CD97) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sheep CD97 Antigen (ADGRE5) ELISA Kit

abx364631-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Cluster of Differentiation 97 (Cd97) Antibody

abx431835-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Leave a Reply

Your email address will not be published. Required fields are marked *